Once were the Living - [2020] spacebusters documentary < - - - video
abodia.com/idx/n/001.html video abodia.com T@abodia.com
Watch video- It has more impact then reading.
Covid 19 vaccine is NOT a vaccine.
It is a cellular, GENETIC MODIFICATION technology, admittedly designed & given those ignorant enough to take it... a self-creating AUTO-IMMUNE DISEASE similar to what used to be called... HIV AIDS
> Part 1: the "test" swab (inserts the micro medical device)
nano-bio-weapon
NESCIENCE vs. IGNORANCE
The CONTEXT of Not Knowing
Nescience From the Latin verb nesciere:
"to not know because knowledge was absent or unattainable."
Ignorance From the Latin verb ignorare:
"to not know even though necessary information is present,
because that information has been willfully refused or disregarded."
- - - The Test is the Vaccine ! Abstract
- - -
https://www.qov.uk/.../regulation-for-the-fourth...
GOV.UK
- - -
Regulation for the Fourth Industrial Revolution:
The Fourth Industrial Revolution is of a scale, speed and complexity that is unprecedented. It is characterized by a fusion of technologies – such as artificial intelligence, gene editing and advanced robotics – that is blurring the lines between the physical, digital and biological worlds. It will disrupt nearly every industry in every country, creating new opportunities and challenges for people, places and businesses to which we must respond.
Our modern Industrial Strategy seeks to put the UK at the crest of this global wave of technological innovation, bringing the benefits to business and consumers alike. Our foundations are strong. The UK ranks in the top five in the Global Innovation Index 1. We are a global leader in science and research and home to four of the top 10 universities in the world 2. We have a thriving start-up environment and are home to many of the world's most R&D-intensive businesses. We develop and attract some of the most talented people in the world.
"These are made by Hitachi. They measure only .15 x .15 mm each and have GPS capabilities! Sometimes called 'smartdust' as they can be sprayed on us and absorbed or taken in foods, drinks and even injected."
Sensors and other Devices
Micro-controller
Processor
Tiny operating system
3 KB RAM manor)
2 Axis Magnetic Sensor
2 Axis Acceleromeler
Light Intensity Sensor
Humidity Sensor
Pressure Sensor
Temperature Sensor
- - - Bill Gates -
A MAN OF GREAT INFLUENCE
GAVI, NIH, WHO, WEF, CDC, Media Action
- - -
A theragripper is about the size of a speck of dust. This swab contains dozens of the tiny devices. Credit: Johns Hopkins University.
Inspired by a parasitic worm that digs its sharp teeth into its host's intestines, Johns Hopkins researchers have designed tiny, star-shaped microdevices that can latch onto intestinal
virus (n.) late 14c "poisonous substance," from Latin virus "poison, sap of plants, slimy liquid, a potent
antigen
n. A substance that when introduced into the body stimulates the production of an antibody. Antigens include toxins, bacteria. foreign blood cells. and the cells of transplanted organ
n. A substance that induces an immune response, usually foreign.
n. any substance (as a toxin or enzyme) that stimulates an immune response in the (especially the production of antibodies)
an Antigen IS a VIRUS...
a foreign POISON that has no business being in your body's interstitial fluids!
Vaccines inserts antigens, toxins, poisons, viruses being injected into your interstitial fluid Hydrogel Biosensor: Implantable Nanotech to be used in COVID [vaccine].
- - -
Vaccines ?
An implantable hydrogel biosensor, made via a DARPA-Gates funded Silicon Valley company. appears to be slated to be used in the upcoming COVID vaccine. The US Department of Defense and the Bill and Melinda Gates Foundation have partnered with Profuse. a Silicon Valley company. to develop a piece of nanotechnology made out of hydrogel (similar
- - -
Hydrogel nanoparticles and nanocomposites for nasal drug/vaccine delivery
Abstract
Over the past few years, nasal drug delivery has attracted more and more attentions, and been recognised as the most promising alternative route for the systemic medication of drugs limited to intravenious administration. Many experiments in …
- - -
Found in a swab test kit!! It is a radio active metal with Bio-infiltrator properties including mind control and DNA direct manipulation. A pyrophosphate ion with Tc-99m adheres to calcium deposits. Calcium is known to be liquefied by 5G frequencies!
Check this out! . . Isotope of technetium is technetium- 99m: it binds chemically to many biologically active molecules, these properties make it suitable for many medical radioactive isotope reactions. When Tc-99m is combined with a tin compound it binds to red blood cells and can therefore be used to map circulatory system disorders. Check this out here.
https://www.lenntech.com/penodic/elements/tc.htm
https://onlyresultscount.com/shop/ols/products/removal-
Rockefeller Foundation has spent decades interconnecting dozens of branches of commerce to adapt to the LockDown, quarantine & other forced measures to give government more control over people and take from people many of their fundamental freedoms. this is not a spontaneous naturally occurring event It is a PLANneDemic.
It has taken 1,000s of hours of planning and interaction. Chart shows some. See LockStep document of 2010 by Rockefeller Foundation.
- - -
What is nanotechnology in medicine?
Do nanoparticles change your DNA?
New research by scientists shows that when cellular barriers are exposed to metal nanoparticles, cellular messengers are released that may cause damage to the DNA of developing brain cells. ... During their interactions with cell membranes and internalization into cells, key signaling pathways and processes are altered. Apr 4, 2018
www ScienceDaily.com 2018/04
Nanoparticles may cause DNA damage to brain cells across a ...
> Part 2:
The mRNA"Vaccine"
Anaphylaxis and AIDS
the Covid 19 "vaccine" is NOT A VACCINE !
"An RNA vaccine isn't a vaccine at all. It doesn't illicit an immune response. It has to be turned into a protein and it's the protein, in turn, that creates the immune response. A messenger RNA vaccine is actually Genetic Engineering. You'll have cells in your body that will produce protein to which your immune system will amount an immune response. That's called an auto-immune disease. The potential for this to go horribly wrong is enormous." Dr Wakefield
- - -
How does mRNA code for proteins?
DNA TACGCACATTTACGTACGCGG
v
mRNA AUGCGUGUAAAUGCAUG(ribosome
protein Met Arg Val Asn Al a Cys Ala
v
aa-aa-aa-aa~-aa-aa-as-aa)
How can you code for 20 amino acids with
Regents Biology only 4 DNA bases (A,U,G,C)?
- - - Virus Structure
You do not CATCH a virus, [ your body produces it ] it if your cells are poisoned.
- - -
DePopulation should be the highest priority of foreign policy towards the third world. - Henry Kissenger
- - -
The Story of Robert Strecker
Campaign: The Strecker Memorandum
Dr. Robert B. Strecker, M.D., Ph.D. practices Internal medicine and gastroenterology In Los Angeles. He is a trained pathologist and holds a Ph.D. In pharmacology. In 1983, Dr. Strecker and his brother, Ted Strecker, an attorney, were preparing a proposal for a health maintenance organization (HMO) for the Security Pacific Bank of California, and needed to know the long-term financial effects of insuring the treatment of AIDS patients. As this information was not readily available in 1983, both brothers began researching medical literature to learn what they could about this relatively new disease. The information they uncovered right from the beginning was so startling to them, so hard to believe, that It would dramatically alter both their lives and lend them on a five-year quest culminating with the creation of The Strecker Memorandum, one of the most controversial and informative tools of our time. StreckerMemorandum.com He asserts, AIDS:
- is a man-made disease,
- is not a homosexual disease,
- is not a venereal disease,
- can be carried by mosquitoes,
- will never be "cured" by a vaccine.
- - -
125 million vaccines were "donated".
NOTHING good is ever FREE that isn't off a tree.
- - -
Chemotherapy is a by-product of the mustard gas used during WW I.
- - -
Pandemic Bonds and World Bank
by Annie Logical
In 2017, after the Red Cross federation failed to account for $100 million in donations, the depts of IDA and IBRD set up a Pandemic bond apparatus in conjunction with the Pander Faculty Framework which collaborated Germ theory with the WHO
- - -
Confessions of an Economic Hit Man
by John Perkins
The United States spends over $87 billion conducting a war in Iraq while the United Nations estimates that for less them half that amount we could provide clean water, adequate diets, sanitation services and basic education to every person on the planet. - John Perkins
- - -
COVID-19 Diagnostic Test instruments and apparatus (902780) exports by country in 2018 Additional Product information: Instruments used In clinical laboratories for In Vitro Diagnosis. Colorimetric end tidal C02 detector, sizes compatible with child and adult endotracheal tube. Single use.
Category: COVID-19 Test kits/ Instruments, apparatus used in Diagnostic Testing
In 2018, Top exporters of COVID-19 Diagnostic Test instruments and apparatus are:
European Union ($2.885,620.49K),
United States ($2,474.886.39K, 3,008,040 Item),
Germany ($2,282,319.47K ),
Japan ($1,292,837.58K),
Singapore ($1,125,969.91K, 62,765,200 Item).
- - - THE CONTAGION MYTH (book) from Barnes & Nobel
Why Viruses (including "Corona virus")
are not the Cause of Disease
by Thomas S. Cowan, MD, and
Sally Fallon Morell.
- - - Pasteur: Plagiarist, Imposter!
The Germ theory Exploded!
by R. B. Pearsen
Pierre Jacques Antoine Beauchamp
(1816-1908) Chemist Biologist, Physician
- Healthy tissue immune to germ infection
- "Biological Terrain" (Germs are Opportunists)
- Support tissue health and wellbeing
- Nutrition/ Rest/ Hygiene Exercise/ Emotional wellbeing [ reduce stress ]
- "The primary cause of disease is in us, always in us."
- Antoine Beauchamp, 1883
"Germs are nothing, the Terrain is everything."
- Theory was ignored by mainstream media and fell into obscurity.
- - -
Doctor on CNN: Don't be 'alarmed' if elderly die after receiving COVID vaccine
- - - DEPOPULATION
Agenda 21 & Agenda 2030
The present vast overpopulation, now far beyond the world carrying capacity, cannot be answered by future reductions in the birth rate due to contraception, sterilization and abortion, but must be met in the present by the reduction of numbers presently existing.
This must be done by whatever means necessary.
- - - LIVESCIENCE
Why an Australian COVID-19 vaccine caused false-positive HIV tests
Australian officials said they had canceled an order for some 51 million doses of the vaccine.
- - - The Disruptive Physician
@DocEvenhouse
Any vaccine that needs to be shipped and stored at -80 degrees isn't a vaccine. It's a transfection agent, kept alive so it can infect your cells and transfer genetic material. Don't let them fool you. This is genetic manipulation of humans on a massive scale. Shut it down.
- - -
Head of Pfizer Research: Covid Vaccine is Female Sterilization
Health and Money News Dec 2 2020
The vaccine contains a spike protein (see Image) called syncytin-1, vital for the formation of human placenta in women. If the vaccine works so that we form an immune response AGAINST the spike protein, we are also training the female body to attack syncytin-1. which could lead to infertility in women of an unspecified duration.
The vaccinations am expected to produce antibodies against spike proteins of SARS-CoV-2. However, spike proteins also contain syncytin-1 homologous proteins, which are essential for the formation of the placenta in mammals such as humans. It must be absolutely ruled out that a vaccine against SARS-CoV-2 could trigger an immune reaction against syncytin-1. as otherwise Infertility of Indefinite duration could result in vaccinated women
The mRNA vaccines from BioNTech/Pfizer contain polyethylene glycol
(PEG) 70% of people develop antibodies against this substance - this means that many people can develop allergic, potentially fatal reactions to the vaccination.
- - - John Bell, Physician
Sir John Irving Bell is a Canadian immunologist and geneticist. From 2006 to 2011, he was President of the Academy of Medical Sciences, and since 2002 he has held the Regius Chair of Medicine at the University of Oxford, UK. He was since 2006 Chairman of the Office for Strategic Coordination of Health Research but as of 2020 is just a regular member. Bell was selected to the Vaccine Taskforce sometime before 1 July 2020. Wikipedia
- - -
"These vaccines are unlikely to completely sterilize the population"
- - - CRISPR
Clustered Regularly Interspaced Short Palindromic Repeats
- - -
ted-tenders electronic daily
Research Protects
Supplement to the Official journal of the EU
For reasons of extreme urgency under Regulation 32(2)(c) related to the release of a Covid-19 vaccine MHRA have accelerated the sourcing and implementation of a vaccine specific AI tool.
Strictly necessary — it is not possible to retrofit the MHRA’s legacy systems to handle the volume of ADRs that will be generated by a Covid-19 vaccine. Therefore, if the MHRA does not implement the AI tool, it will be unable to process these ADRs effectively. This will hinder its ability to rapidly identify any potential safety issues with the Covid-19 vaccine and represents a direct threat to patient life and public health.
Reasons of extreme urgency — the MHRA recognizes that its planned procurement process for the SafetyConnect programme, including the AI tool, would not have concluded by vaccine launch. Leading to a inability to effectively monitor adverse reactions to a Covid-19 vaccine.
Events unforeseeable — the Covid-19 crisis is novel and developments in the search of a Covid-19 vaccine have not followed any predictable pattern so far.
- - - Specialist Pharmacy Service
the first step for professional medicines advice
COVID-19 Vaccines Guidance
Managing anaphylaxis in the COVID-19 vaccination
Helen Davis. UKMi. Director. North West Medicines Information Centre • Published 29 December 2020 • Last updated 12 January 2021 See all updates.
Advice on managing anaphylaxis in the vaccination setting with specific reference to COVID-19 vaccines.
- - - Charles Richet. Nobel Lecture.
December 11, 1913
Anaphylaxis
In 1903 Arthus, in Lausanne, showed that a first intravenous injection of serum on a rabbit causes anaphylaxis, i.e. three weeks after the first injection the rabbit is hypersensitive to the second injection. The phenomenon of anaphylaxis was becoming of general application. Instead of applying only to toxins and toxalbumins. it held good for all proteins, whether toxic at the first injection or not.
Two years later Rosenau and Anderson. two American physiologists. demonstrated in a noteworthy piece of work that the phenomenon of anaphylaxis occurs after every injection of serum, even when the injection is minute, for example of 0.00001 ml which is an infinitely small amount but nevertheless sufficient to anaphylactize an animal. They quoted examples of anaphylaxis from all organic liquids: milk, serum, egg, muscle extract. They specified the reaction and clearly showed that of all the subjects, the guinea-pig appeared the most sensitive in anaphylactic terms.
Phylaxis. a word seldom used, stands in the Greek for protection. Anaphylaxis will thus stand for the opposite. Anaphylaxis. from its Greek etymological source, therefore means that state of an organism in which it is rendered hypersensitive, instead of being protected.
To make this plain, we will consider the example of a subject that has received a poison.
Let us suppose the dosage to be moderate and that after a few days the subject is, or at least appears to be, normal. If, at this point, a further injection is given of the same dosage of the same poison, what will happen?
But it is a much harder task to state when the anaphylactic period has actually passed. Most writers incline to the view (and I myself would think them correct in their view) that the anaphylactic state never passes. In other words, once a subject has been anaphylactized and consequently modified in his chemical constitution, then the subject can never go back to his former state. Return to normal is not possible. Subjects have been known who even after four years from the date of the first serum injection, were still sensitive to the unleashing reaction.
Let me add in passing that it is an extraordinary phenomenon that so insignificant a quantity of poison can modify the organism to the extent that the succeeding days down long years can not eradicate this indelible modification. Unfortunately minute researches on just this point are still lacking. But it certainly looks as though considerable differences will be found in the duration of anaphylactization.
Anaphylactic symptoms also vary to a great extent, although the differences are marked rather according to the nature of the experimental animal than according to the nature of the poison used. It is indeed worthy of note to find that the phenomena are constant, whatever the poison used.
An unexpected phenomenon arose, which we thought extraordinary. A dog when injected previously even with the smallest dose, say of 0.005 liquid per kilo, immediately showed serious symptoms : vomiting, blood diarrhoea, syncope. unconsciousness, asphyxia and death. This basic experiment was repeated at various times and by 1902 we were able to state three main factors which are the corner-stone of the history of anaphylaxis: (1) a subject that had a previous injection is far more sensitive than a new subject; (2) that the symptoms characteristic of the second injection, namely swift and total depression of the nervous system. do inn in .any way resemble the symptoms characterizing the first injection: (3) a three or four week period must elapse before the anaphylactic state results. This is the period of incubation.
The U.K. National Health Service has pushed back the window for people to receive the second dose of the COVID-19 vaccine made by Pfizer and BioNTech - to a duration the companies tested on only a small percentage of patients.
The NHS wrote a letter to hospitals saying those who are scheduled to receive their second dose after Jan. 4 should be rescheduled from three weeks' time to 12, with most recipients booked in the last week of that time frame. The move would bring the window closer to the time frame for the just-approved vaccine made by the University of Oxford and pharmaceutical company AstraZeneca AZN, +0.80%.
The NHS said the move would protect the greatest number of at rick people in the shortest period and have the greatest impact on mortality.
- - -
Biden Reverses Trump Order to lower prices of Insulin and Epipens
- - -
FDA Safety Surveillance of COVID-19 Vaccines
DRAFT Working list of possible adverse event outcomes
***Subject to change***
Guillain-Barre syndrome
Acute disseminated encephalomyelitis
Transverse myelitis
Encephalitis/myelitis/encephalomyelitis/
meningoencephalitis/meningitis/
encepholapathy
Convulsions/seizures
Stroke
Narcolepsy and cataplexy
Anaphylaxis
Acute myocardial infarction
Myocarditis/pericarditis
Autoimmune disease
Deaths
Pregnancy and birth outcomes
Other acute demyelinating diseases
Non-anaphylactic allergic reactions
Thrombocytopenia
Disseminated intravascular coagulation
Venous thromboembolism
Arthritis and arthralgia/joint pain
Kawasaki disease
Multisystem Inflammatory Syndrome in Children
Vaccine enhanced disease
> Part 3:
Severe Adverse Reactions and DEATH
COVID-19 Deaths by Age
Age in years - covid related deaths
Less than 1 - 39
1 to 4 21
5 to 14 58
15 to 24 525
25 to 34 2,278
35 to 44 5,991
45 to 54 16,282
55 to 64 40,758
65 to 74 73,856
75 to 84 95,848
85 + 111,475
- - -
The Centers for Disease Control and Prevention (CDC) released new data last week that shows the majority of people who have died from COVID-19 had pre-existing medical conditions.
Only 6% of deaths have only COVID-19 listed in the death report, according to the CDC.
"For 6% of the deaths, COVID-19 was the only cause mentioned," the report said. "For deaths with conditions or causes in addition to COVID-19, on average, there were 2.6 additional conditions or causes per death."
The website listed some of the top pre-existing conditions listed in COVID-19-related deaths as:
• Heart Disease
• Renal Failure
• Diabetes
• Influenza and pneumonia
• Respiratory failure
• Cardiac arrhythmia
- - -
CNN health
Dr. Kelly Moore, associate director of the Immunization Action Coalition
"One of the things we want to make sure people understand is that they should not be unnecessarily alarmed if there are reports, once we start vaccinating of someone or multiple people dying within a day of two of their vaccination who are residents of a long-term care facility. that would be something we would expect, as a normal occurrence, because people die frequently in nursing homes."
- - - HealthImpactNews.com
24 Dead and 137 Infected at NY Nursing Home After Experimental COVID injections
- - -
Gibraltar is 2.6 square miles in size. On 6th of January they had only 10 covid deaths in total.
The vaccine arrived to the island on 10th January. By 20th of January there were 53 deaths.
Today worldometer is showing that there are now 70 deaths. SEVENTY!!
Why is no one talking about Gibraltar?
- - -
211 deaths and over 42,000 side effects reported on VAERS so far from the covid vax. Many Dr.'s don't use VAERS so this is a huge number !
- - -
More Than 82.5 Million Shots Given: Covid-19 Tracker
The U.S. has administered 25.6 million doses; vaccine campaign goes global
Updated: January 27.2021,11:05 PM GMT+1
- - -
CDC data shows high virus survival rate:
99% plus for ages 69 and younger,
94.6% for older people.
- - -
Shipping CADAVER BAGS
Adult - Plastic - Straight - Zipper
38" x 90"
Quantity 10 each
- - -
Total Deaths per year In the United States According to the CDC
2015: 2,712,630
2016: 2,744,248
2017: 2,813,503
2018: 2,839,205
2019: 2,900,689
2020: 2,487,350 (as of Nov. 16, '20)
2020: 2,487,350 + 447,459 year end '20
- - -
The Flu has virtually Disappeared in Australia
Irish Health Chief says "Fortunately there's no Flu this season.
[ or they just calling covid, what last year they called Flu ? ]
Source. World Health Organization FluNet
BloombergOpinion
- - -
The Smoking Gun: Where is the Coronavirus?
The CDC says it isn't available.
The CDC document is titled,
"CDC 2019-Novel Coronavirus (2019-nCoV) real-Time RT-PCR Diagnostic Panel" It is dated July 13, 2020
Buried deep in the document, on page 39, in a section titled, “Performance Characteristics,” we have this: “Since no quantified virus isolates of the 2019-nCoV are currently available, assays [diagnostic tests] designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA…”
Every object that exists can be quantified, which is to say, measured. The use of the term “quantified” in that phrase means: the CDC has no measurable amount of the virus, because it is unavailable. THE CDC HAS NO VIRUS.
A further tip-off is the use of the word ‘isolates.” This means NO ISOLATED VIRUS IS AVAILABLE.
Another way to put it:
NO ONE HAS AN ISOLATED SPECIMEN OF THE COVID-19 VIRUS.
THEREFORE, NO ONE HAS PROVED THAT IT EXISTS.
As if this were not enough of a revelation to shock the world, the CDC goes
RT-PCR Test to Detect SARS-CoV-2 Reveals 10 Major Scientific Flaws at the Molecular and Methodological Level: Consequences for False Positive Results
The first and major issue is that the novel Coronavirus SARS-CoV-2 (in the publication named 2019-nCoV and in February 2020 named SARS-CoV-2 by an international consortium of virus experts) is based on in silico (theoretical) sequences, supplied by a laboratory in China [1], because at the time neither control material of infectious (“live”) or inactivated SARS-CoV-2 nor isolated genomic RNA of the virus was available to the authors. To date no validation has been performed by the authorship based on isolated SARS-CoV-2 viruses or full length RNA thereof. According to Corman et al.:
“We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings without having virus material available.” [1]
- - -
Life Without by Stanley Johnson
Quote from the Introduction
'Action on the population front means somehow trying to slow down or even halt this rate of growth by reducing the number of babies who are born each year. The alternative to this, both pessimists and optimists are agreed, is inevitable. If the number of new births cannot be reduced, the number of deaths each year must increase until the net growth of the world's population is cut down to a more manageable number. This business of an increase in the death rate is not, of course, attractive. The recipes - which include thermonuclear war, global famine, plague and a newly discovered horror called 'ecocatastrophe' are all unpalatable. At the same time, the task of achieving a reduction in the global birth rate (which I call population control for the sake of simplicity) though clearly more death is also a form of ARTXUS
- - - GLOBAL POPULATION CONTROL
October 25 2007
Global over-population Is the real Issue
It is a tragic manure of how far the world has changed - and the infinite capacity of modern man for taking offence - that there are no two subjects that can gt you more swiftly Into political trouble than motherhood and apple pie.
The last time I tentatively suggested that there was something to be said in favour of apple pie. I caused a frenzy of hatred in the healthy eating lobby. It reached such a pitch that journalist were actually pelting me with pies, and demanding a retraction. and an apology and a formal denunciation of the role of apple pie in causing obesity,
As for motherhood - the fertility of the human race we are getting …
- - -
"The world's population is now 6.7 billion roughly double what it was when I was born. If I live to be in my mid-eighties, then it will have trebled in my lifetime... I simply cannot understand why no one discusses this impending calamity, and why no world statesmen have the guts to treat the issue with the seriousness it deserves... We seem to have given up on population control." - Boris Johnson, [ PM, London]
Telegraph, 25 October 2007
- - - COVID-19 is turning out to be a huge hoax perpetrated by the media.
- - - See hoax of 2009 Swine Flu Pandemic
> Part 4:
The Solution - A Convenient Truth
shingles vitamin A & D deficient.
polio vitamin A & B deficient.
rotavirus vitamin A & D deficient.
pneumonia vitamin A & D deficient.
pneumococcal vitamin A & D deficient.
tetanus vitamin A deficient.
pertussis vitamin D deficient.
(treated with vitamin C)
influenza vitamin D deficient.
The unsuccessful history of virus and microbe theories
Favouring virus and microbe theories has delayed the cure of many diseases
disease presumed cause actual cause
scurvy Microbe Vitamin C deficiency
affecting 19th century English sailors
pellagra Microbe vitamin B deficiency
1920's in USA.
scrapiemsna Retrovirus Genetic
affecting sheep in Iceland from 1930's to 1950's
tertiary syphilis: Treponemes Mercury, arsenic poisoning
before 1950s
- - - James Hildreth, M.D.
President and Chief Executive Officer
of Meharry Medical College
Former Professor at Johns Hopkins
HIV researcher
"… the virus is fully an exosome in every sense of the word."
- - - Glucose is SUGAR
Check out the garbage
i.e. threads of fungi (mould avoid sugar in all forms)
- - - Big Parma is just a Big Cartel
- - -
PCR Tests Show Positive because they respond to genetic material present in all humans
August 28, 2020 - Piece of Mindful, David Icke and Amandha Vollmer
- - -
One of the WHO primer sequences in the PCR test for SARS-CoV-2 is found in all human DNA
By Fauxlex - Apr 06.20
- - -
We have Positive Covid tests of:
Kiwi, Goat, Bird. Coca Cola, Papaya. Durian, Blank Test, Apple Juice
- - -
Bacterial genome sequence are hundreds of thousands and long and human sequences can be 145 million long ...
- - - Once were the Living - Ted's notes
[2020] spacebusters documentary
https://www.nightcurves.com/nischl/1784/once-were-the-living-documentary/ or at
abodia.com
17:45 Dr. Lorraine Day talks of the messenger RNA changing our DNA.
Covid vaccine is NOT a vaccine.
Covid vaccine is a medical device designed to stimulate the human cells to become a pathogen creator.
Either the arm jab or the swab in your nose, both implant a nano internal medical device in your body. It implants you with the nano particles. This device can be programmed.
Mind Control at 25 min.
Notes from Bitchute video.
There are 1,000s of files, articles, books, videos about corona, virus, pandemic, quarantine, masks, contact tracing.
Follow any idea, people, event to other, deeper, broader information.
Know more & better information searching internet than you get from lying news.
Many people/ organizations lie to increase their wealth, power and control over us.
Confirm anything with ThoughtPrint..org
I share 400,000+ files.
Gen. P.O., zip exempt.
Ted Elden. General Delivery.
Charleston, W. Va. [ 25301-9999 ]
a@abodia.com abodia.com
Contact me to join in on our open weekly conference calls. abodia.com/t/call
We suffer under great evil because we choose to NOT consider it.
Hosea 4:6 My people suffer for lack of knowledge
John 8:32 Truth will make/ set us free.
Psalms 18:13 To judge (accept) a matter without investigating it is foolish !
Hebrews 11:1 Faith is the substance of things hoped for,
the evidence of things unseen.
Scriptures contain what we need to know.
Yahweh guides us thru His Word, His son Yahushua and thru His Holy Spirit, our intuitive, inner voice.
The more that you consider, reflect, learn, act of Yahweh's will in our life,
the less problems and more benefits & blessings we may have.